AAS Open Res AAS Open Research 2515-9321 F1000 Research Limited London, UK 10.12688/aasopenres.13021.1 Research Article Articles Detection of blood pathogens in camels and their associated ectoparasitic camel biting keds, Hippobosca camelina: the potential application of keds in xenodiagnosis of camel haemopathogens

[version 1; peer review: 1 approved, 1 approved with reservations]

 Kidambasi Kevin O. Conceptualization Formal Analysis Investigation Methodology Validation Visualization Writing – Original Draft Preparation https://orcid.org/0000-0003-1963-070X 1 1 2 2 Masiga Daniel K. Funding Acquisition Project Administration Resources Supervision Validation Visualization Writing – Review & Editing https://orcid.org/0000-0001-7513-0887 2 2 Villinger Jandouwe Formal Analysis Methodology Resources Supervision Validation Visualization Writing – Review & Editing https://orcid.org/0000-0002-5097-6605 2 2 Carrington Mark Formal Analysis Funding Acquisition Resources Supervision Validation Visualization Writing – Review & Editing 3 3 Bargul Joel L. Conceptualization Formal Analysis Funding Acquisition Investigation Methodology Project Administration Resources Supervision Validation Visualization Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0000-0001-8573-6807 a 1 1 2 2 Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Nairobi, Nairobi, P.O.Box 62000-00200, Kenya Animal Health Department/Molecular Biology and Bioinformatics Unit, International Centre of Insect Physiology and Ecology, Nairobi, P.O. Box 30772-00100, Kenya Department of Biochemistry, University of Cambridge, Tennis Court Road, Cambridge, CB2 1QW, UK jlbargul@gmail.com

No competing interests were disclosed.

 5 11 2019 2019 2 164 30 10 2019 Copyright: © 2019 Kidambasi KO et al. 2019 This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background: Major constraints to camel production include pests and diseases. In northern Kenya, little information is available about disease pathogens circulating in one-humped camels ( Camelus dromedarius) or their possible transmission by the camel haematophagous ectoparasite, Hippobosca camelina, commonly known as camel ked or camel fly. This study aimed to: (i) identify the presence of potentially insect-vectored pathogens in camels and camel keds, and (ii) assess the potential utility of keds for xenodiagnosis of camel disease pathogens that they may not vector.

Methods: In Laisamis, northern Kenya, camel blood samples ( n = 249) and camel keds ( n = 117) were randomly collected from camels. All samples were screened for trypanosomal and camelpox DNA by PCR, and for Anaplasma, Ehrlichia, Brucella, Coxiella, Theileria, and Babesia by PCR coupled with high-resolution melting (PCR-HRM) analysis.

Results: In camels, we detected Trypanosoma vivax (102/249) (41%), Trypanosoma evansi (3/249) (1.2%), and “ Candidatus Anaplasma camelii” (137/200) (68.5%). In camel keds, we also detected T. vivax (53/117) (45.3%), T. evansi (3/117) (2.56%), Trypanosoma melophagium (1/117) (0.4%), and “ Candidatus Anaplasma camelii” (19/117) (16.24 %). Piroplasms ( Theileria spp. and Babesia spp.), Coxiella burnetii, Brucella spp., Ehrlichia spp., and camel pox were not detected in any samples.

Conclusions: This study reveals the presence of epizootic pathogens in camels from northern Kenya. Furthermore, the presence of the same pathogens in camels and in keds collected from sampled camels suggests the potential use of these flies in xenodiagnosis of haemopathogens circulating in camels.

 Camelus dromedarius Hippobosca camelina haemopathogens xenodiagnosis high-resolution melting analysis Global Challenges Research Fund G100049/17588 Cambridge-Africa Alborada Fund International Foundation for Science B/5925-1 Government of the Republic of Kenya Department for International Development Direktion für Entwicklung und Zusammenarbeit African Academy of Sciences DEL-15-011 Wellcome Trust 107742/Z/15/Z;WellcomeTrustInvestigator Styrelsen för Internationellt Utvecklingssamarbete This work was supported through the DELTAS Africa Initiative grant # DEL-15-011 to THRiVE-2. The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS)’s Alliance for Accelerating Excellence in Science in Africa (AESA) and supported by the New Partnership for Africa’s Development Planning and Coordinating Agency (NEPAD Agency) with funding from the Wellcome Trust grant # 107742/Z/15/Z and the UK government. This research study received supplementary funding from the International Foundation for Science (IFS), Stockholm, Sweden, through an IFS grant # B/5925-1 to JLB; and from Cambridge-Africa Alborada Fund 2017/18 and The Global Challenges Research Fund - Pump-Priming Fund (GCRF grant #G100049/17588) awarded to MC and JLB. Additional support was obtained from icipe institutional funding from the UK’s Department for International Development (DFID), the Swedish International Development Cooperation Agency (SIDA), the Swiss Agency for Development and Cooperation (SDC), and the Kenyan Government. MC is a Wellcome Trust Investigator. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Introduction

Camels are the most valuable livestock for pastoralist farmers living in arid and semi-arid lands (ASALs) in Kenya ( Mochabo et al., 2005). Among other benefits, they provide milk, meat, transport, and income through sale of animal products ( Faye, 2014; Oryan et al., 2008). There are no other livestock species that have such versatile uses to pastoralists living in ASALs ( Faye, 2014). Over three million one-humped camels are estimated to be in northern Kenya ( FAOSTAT, 2015; KNBS, 2010), which represents the third largest camel population in Africa after Somalia and Sudan ( Lamuka et al., 2017). Camels are resilient to harsh conditions of ASAL regions characterized by long periods of drought, scarcity of vegetation and water, and unpredictable rainfalls. However, camel pests and diseases are the major constraints to camel production ( Higgins, 1985; Kassa et al., 2011; Mochabo et al., 2005). Additionally, the constant association between camels and humans, co-herding of livestock species, and communal watering of animals, as well as sharing of water troughs by the domestic and wild animals, exacerbate the spread of zoonotic diseases, which poses a great risk to public health among livestock and humans in Kenya’s north ( Bengis et al., 2002; Kazoora et al., 2014; Lamuka et al., 2017; Younan & Abdurahman, 2014). Thus, there is a need for constant surveillance of infectious agents circulating within the camel herds in order to guide control and treatment of these diseases.

Camels are vertebrate hosts of various haematophagous arthropods including Hippobosca spp. (also known as keds or hippoboscids), horse flies, stable flies, Lyperosia spp., and ticks ( Higgins, 1985). In addition to the direct effects such as blood loss, annoyance, and painful feeding bites, these biting pests can be vectors of infectious disease pathogens ( Baldacchino et al., 2013; Higgins, 1985; Young et al., 1993). Biting flies such as tabanids and Stomoxys have been implicated in the transmission of viruses (including bluetongue and Rift Valley fever viruses), rickettsiae (e.g. Anaplasma, Coxiella), Bacillus anthracis, and protozoa ( Besnoitia besnoiti, Haemoproteus metchnikovii, Trypanosoma theileri, Trypanosoma evansi, Trypanosoma equiperdum, Trypanosoma vivax, Trypanosoma congolense, Trypanosoma simiae, Trypanosoma brucei) in their specific vertebrate hosts (reviewed by Baldacchino et al., 2013).

Hippoboscids (keds) are obligate haematophagous ectoparasites of mammals and birds that belong to the family Hippoboscidae within the superfamily Hippoboscoidae ( Petersen et al., 2007; Rahola et al., 2011). This family of haematophagous dipterans is divided into three subfamilies, Lipopteninae, Ornithomyiinae, and Hippoboscinae ( Rani et al., 2011). Hippoboscidae and Glossinidae (tsetse; i.e. the definitive vector of African trypanosomes) belong to the same superfamily Hippoboscoidae, which is characterized by adenotrophic viviparity ( Petersen et al., 2007). Members of Hippoboscidae act as vectors of several infectious agents including protozoa, bacteria, helminths, and viruses ( Rahola et al., 2011). Hippobosca camelina is the predominant ectoparasite of camels in northern Kenya. This haematophagous fly acquires blood meals mainly from camels for its nourishment and reproduction. The role of keds in disease transmission is not well established. Furthermore, as primarily long-term camel blood-feeders, they may have potential in xenosurveillance of disease pathogens within camel herds that they may not transmit. Therefore, this study was undertaken to (i) detect the presence of infectious viruses, bacteria, protozoa, and rickettsial pathogens, particularly those responsible for zoonoses, in camels and hippoboscids associated with them, and (ii) study the potential utility of hippoboscids in xenodiagnosis.

 Methods Study area

The study was carried out in Laisamis (1° 36' 0" N 37° 48' 0" E, 579 m above sea level) located in Marsabit County, northern Kenya ( Figure 1). The County of Marsabit in Kenya has a total area of 70,961km 2 and occupies the extreme part of northern Kenya (Source: County Commissioner’s Office, Marsabit, 2013). Area of the Laisamis sub-County that consists of four County Assembly Wards is 20,290 km 2 with a population of 84,056 people consisting of about 41,240 males and 42,871 females ( KNBS, 2013). Laisamis electoral ward, one of the four County Assembly Wards of Laisamis sub-County in Marsabit County, has an area of 3,885 km 2.

A map of Kenya showing the study sites in Laisamis, Marsabit County, Kenya.

Camel blood samples were collected from camel herds during the day, shortly after drinking water from the wells dug along Koya semi-permanent river (circle filled in red), whereas camel keds were collected from the same herds later at night when these camels returned to their temporary settlements shown on the map by circles (filled in red) inside a dotted green square.

 Weather conditions

The average temperature in Laisamis is 26.5°C (19°C – 30°C; March is the warmest month, whereas July is the coldest month of the year). About 413 mm of precipitation falls annually, the average rainfall amounts and rain days differ between years. Long rains occur mostly during April - June, while short rains are experienced in October - December. On the other hand, short dry seasons occur between January and March, whereas long dry spells are experienced between July and September ( SSFR, 2017). However, unpredictable and irregular climatic patterns are becoming more common, with no rainfall in some years leading to frequent droughts in the arid and semi-arid regions of northern Kenya.

 Study design and sample collection

This field study was cross-sectional in design and samples were collected after receiving informed verbal consent from camel keepers. All camel keepers were neither able to read nor write, thus verbal rather than the written consent was adopted as the pragmatic approach. The coordinates of each sampling site were geo-referenced with a Global Positioning System (GPS).

 Camel blood samples

In September 2017, 249 clinically healthy dromedary camels of both sexes (203 females and 46 males) were sampled in Laisamis sub-County, along Koya River (01° 23’ 11” N, 37° 57' 11.7" E). We sampled all camels from different herds daily over a 5-day sampling period. Koya River was selected for sampling as it contains permanent watering points and nomadic pastoralists converge here after traveling many kilometers with their livestock in search of drinking water. About 5 mL of camel blood was drawn from jugular vein into a heparinised vacutainer and immediately preserved in liquid nitrogen at -196°C for transportation to molecular biology laboratories at the International Centre of Insect Physiology and Ecology ( icipe, Nairobi) for analysis.

 Collection of camel keds, <italic toggle="yes">H. camelina</italic>

Camel keds closely associate and move with their host as they firmly attach to the hairs on camel’s skin using tarsal claws. These blood feeders are mainly observed on the underbelly ( Figure 2), although they can be found on other parts of the body such as the neck and hump. Since we observed that keds are best collected under the cover of darkness at night, we collected blood samples at the water drinking point, then later in the evening followed the same camel herds for fly collection. Flies were collected off camels from four sites (Sarai – 01° 30’ 33.2” N, 037° 52’ 34.4” E; Sarai maririwa/Kilakir – 01° 35’ 20.5” N, 037° 48’ 39.7” E; Lapikutuk Lelembirikany – 01° 30’ 42.9” N, 037° 52’ 53.5” E; Noldirikany’ – 01° 30’ 04.2” N, 037° 54' 50.7" E) by handpicking using spotlights that were briefly switched on and off in order to locate flies on the camels. We aimed to collect all flies present on the individual camels in all 21 sampled herds. Freshly collected camel keds were preserved in absolute isopropanol and transported to icipe for molecular screening of infectious agents.

<italic toggle="yes">Hippobosca camelina</italic> flies infesting camels.

These ectoparasites are mostly found on the belly of the host as shown in A & B. Over 30 flies were found concentrated on a small section of underbelly of the camel next to the udder. These flies mostly infest the underbelly and occasionally on the other parts of the camel’s body where they are not prone to disturbance by the host.

 Collection of other biting flies

To identify the common species of hematophagous biting flies found in Laisamis sub-County and Koya, we deployed monoconical traps, using cow urine and acetone as attractants. Traps were deployed daily at 9:00 am for nine consecutive days in selected sampling sites near livestock pens and next to watering points along Laisamis and Koya rivers. The trapped flies were collected at 6:00 pm and preserved in 50 mL Falcon tubes half-filled with absolute ethanol for morphological identification at icipe (Nairobi), and species identification through comparison with known hippoboscid collections at the Zoology museum of the University of Cambridge (UK), and the Natural History Museum in London. These trapped biting flies were not screened for disease pathogens.

 Ethical approval

This study was undertaken in strict adherence to experimental guidelines and procedures approved by the Institutional Animal Care and Use Committee at icipe (REF: IACUC/ICIPE/003/2018). All efforts were made to minimize pain and discomfort during sampling. For instance, camel keepers, with whom camels were familiar, were allowed to restrain their camels for sample collection. Prior to issuance of ethical approval by icipe’s IACUC, JB – the principal investigator – undertook CITI training program on animal care and use, working with mice and rabbits in research settings.

 DNA extraction

Each H. camelina fly was surface-sterilized with 70% ethanol and allowed to air dry for 10 min on a paper towel on top a clean bench. Individual flies were placed into a clean 1.5-mL centrifuge tubes containing sterile 250 mg of zirconia beads with 2.0-mm diameter (Stratech, UK) and ground in liquid nitrogen in a Mini-Beadbeater-16 (BioSpec, Bartlesville, OK, USA) for 3 min. Genomic DNA was extracted from camel keds and camel blood samples using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.

 Detection of pathogen DNA

Detection of Coxiella burnetii, Anaplasma spp., Ehrlichia spp., Brucella spp., and piroplasms belonging to Theileria and Babesia genera employed PCR followed by DNA fragment analysis based on high-resolution melting (HRM) analysis ( Šimenc & Potočnik, 2011) in a Rotor-Gene Q thermocycler (Qiagen, German). Coxiella burnetii DNA was screened for using primers ( Table 1) targeting the IS1111 gene ( Tokarz et al., 2009). Anaplasma and Ehrlichia were detected by PCR amplification using genus-specific primers, AnaplasmaJVF/AnaplasmaJVR and EhrlichiaJVF/ EhrlichiaJVR, respectively, as previously described by Mwamuye et al. (2017) ( Table 1). Babesia and Theileria spp. DNAs were amplified using primers RLB-F1 and RLB-R1 ( Table 1) targeting the hypervariable V4 region of 18S rRNA genes ( Georges et al., 2001). The PCRs were carried out in 10-μL reaction volumes, containing 2.0 μL of 5× HOT FIREPol EvaGreen HRM mix (no ROX) (Solis BioDyne, Estonia), 0.5 μL of 10 pmol of each primer, 6.0 μL PCR water and 1.0 μL of template DNA. For Brucella spp., the reactions were carried out in 10-μL reaction volumes, containing 2.0 μL of 5× HOT FIREPol EvaGreen HRM mix (no ROX) (Solis BioDyne, Estonia), and 0.5 μL of 10 pmol of each primer of three primers; Brucella arbutus forward primer, B. melitensis forward primer, and Brucella spp. universal reverse primer targeting the IS711 gene ( Probert et al., 2004), 5.5 μL PCR water and 1.0 μL of template DNA. PCR amplification was preceded by an initial enzyme activation at 95°C for 15 min, followed by 10 cycles at 94°C for 20 sec, step-down annealing from 63.5°C with decrements of 1°C after each cycle for 25 sec, and primer extension step at 72°C for 30 sec; then 25 cycles of denaturation at 94°C for 25 sec, annealing at 50.5°C for 20 sec, and extension at 72°C for 30 sec followed by a final elongation at 72°C for 7 min. Immediately after PCR, HRM profiles of amplicons were obtained by increasing temperature gradually from 75 to 90°C at 0.1°C/2 sec increments. Changes in fluorescence with time (dF/dT) were plotted against changes in temperature (°C).

Primers for amplification of target genes for detection of disease-causing camel pathogens.

Primers sequences were sent to inqaba biotec™ (Muckleneuk, Pretoria, South Africa) for synthesis.

Primer name 5’to 3’ sequence Target organism Target gene Product size (bp) References for primers
IS1111F IS1111F GTA ATA TCC TTG GGC GTT GAC G ATC TAC GCA TTT CAC CGC TAC AC C. burnetii Coxiella 16S rRNA 242 ( Doosti et al., 2014)
AnaplasmaJV F AnaplasmaJV R CGGTGGAGCATGTGGTTTAATTC CGRCGTTGCAACCTATTGTAGTC Anaplasma spp. Anaplasma 16S rRNA 300 ( Mwamuye et al., 2017)
EhrlichiaJV F EhrlichiaJV R GCAACCCTCATCCTTAGTTACCA TGTTACGACTTCACCCTAGTCAC Ehrlichia spp. Ehrlichia 16S rRNA 300 ( Mwamuye et al., 2017)
EHR16SD 1492R GGTACCYACAGAAGAAGTCC GGTTACCTTGTTACGACTT Ehrlichia & Anaplasma spp. 16S rRNA 1000 ( Parola et al., 2000; Reysenbach et al., 1992)
RLB F RLB R GAGGTAGTGACAAGAAATAACAATA TCTTCGATCCCCTAACTTTC Theileria & Babesia spp. Theileria & Babesia 18S rRNA 450
CMLVC18LF CMLVC18LR GCGTTAACGCGACGTCGTG GATCGGAGATATCATACTTTACTTTAG Camel pox C18L gene 243 ( Balamurugan et al., 2009)
B. arbutus F B. melitensis F Brucella IS711T R GCGCTCAGGCTGCCGACGCAA GCGGCTTTTCTATCACGGTATTC GGGTAAAGCGTCGCCAGAAG Brucella spp IS711 ( Probert et al., 2004)
ITS1_CF ITS1_BR CCGGAAGTTCACCGATATTG TTGCTGCGTTCTTCAAC- GAA Trypanosoma spp. ITS1 250-720 ( Njiru et al., 2005)
ILO 7957F ILO 8091R GCCACCACGGCGAAAGAC TAATCAGTGTGGTGTGC T. evansi RoTat 1.2 488 ( Urakawa et al., 2001)

Pathogenic animal African trypanosomes and camelpox were detected by PCR in a ProFlex thermocycler (Applied Biosystems). Trypanosome DNA was amplified by targeting trypanosomal internal transcribed spacer region using the following universal primer sets described by Njiru et al. (2005); ITS1_CF and ITS1_BR ( Table 1) in 10-µL PCR volumes containing 0.1 units of Phusion DNA polymerase (Finnzymes, Espoo, Finland), 2 µL of 5× HF buffer, 0.2 µL of 10 mM dNTPs, 0.2 µL of 10 mM of each primer and 6.3 µL of nuclease free water. The PCR conditions were as follows: 98°C for 1 min, 40 cycles of 98°C for 30 sec, 61°C for 30 sec, and 72°C for 45 sec, with a final elongation step of 7 min at 72°C. Camel pox C18L gene was amplified using CMLV C18LF and CMLV C18LR primers described by Balamurugan et al. (2009). The PCRs were carried out in a 10-µL reaction mixtures containing 5.0 µL of DreamTaq Green PCR master mix (2×) (Thermo Scientific), 0.5 µL of 10 mM of each primer, 1.0 µL of DNA template, and 3.0 µL of nuclease-free water. The PCR thermocycling conditions included; initial denaturation at 95°C for 3 min, 35 cycles of 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec followed with a final elongation of 72°C for 5 min. The PCR amplicons were electrophoresed on 1.5% ethidium bromide-stained agarose gel and visualized under ultraviolet light.

 DNA purification and sequencing

Representative positive samples producing distinct amplicons with expected band sizes relative to the known positive DNA controls were selected for amplification in larger PCR reaction volumes (30-μL). The PCR amplicons separated by electrophoresis in ethidium bromide-stained 1.5% agarose gels and visualized under ultraviolet light. The target bands were excised and gel purified using QIAquick PCR purification kit (Qiagen, Germany) according to manufacturer’s instructions. The purified amplicons were sent to Macrogen Inc. (Netherlands) for Sanger sequencing.

Since it is not possible to resolve the trypanozoon species using ITS1 primers, which give 480-bp PCR product sizes ( Njiru et al., 2005), two samples positive for Trypanozoon, one from camel and the other from hippoboscid, were amplified using ILO 7957F and ILO 8091R primers ( Table 1) targeting RoTat 1.2 VSG gene described by Urakawa et al. (2001).

To identify the Anaplasma species associated with the HRM peaks observed, amplicons of two samples positive for Anaplasma spp., one from camels and one from camel ked, were selected for sequencing using AnaplasmaJVF and AnaplasmaJVR targeting 300-bp of Anaplasma 16S rRNA genes. These primers could not resolve Anaplasma to species level. To resolve the Anaplasma to species level, a longer 1000-bp fragment of Anaplasmataceae 16S rRNA gene was further amplified by PCR using published primers EHR16SD and 1492R ( Parola et al., 2000; Reysenbach et al., 1992, Table 1), and sequenced. The PCR amplifications were performed in a ProFlex PCR system (Applied Biosystems by life technologies) with the following cycling conditions: 95°C for 15 min; two cycles of 95°C for 20 sec, 58°C for 40 sec, and 72°C for 90 sec; three cycles of 95°C for 20 sec, 57°C for 30 sec, 35 cycles of 95°C for 20 sec, 56°C for 40 sec and 72°C for 90 sec, and a final extension at 72°C for 10 min ( Bastos et al., 2015).

 Data analysis

Data on sampled camels and hippoboscids were entered into Microsoft Excel spreadsheet, version 12.3.1. Ground truthing was done using spatial coordinates generated using GPS Garmin device. The geo-referenced data on sampling locations were fed into a GIS package (ArcGIS v 10.6) and maps generated.

Using the MAFFT plugin in Geneious Prime 2019.1.1 software version (created by Biomatters) ( Kearse et al., 2012), all study nucleotide sequences were edited and aligned with related sequences identified by querying in the GenBank nr database using the Basic Local Alignment Search Tool ( www.ncbi.nlm.nih.gov/BLAST/).

 Results Detections of pathogens

Out of 249 camel samples screened, 102 (40.96%) tested positive for trypanosomes by ITS1 PCR ( Table 2). All trypanosome positive samples were infected with T. vivax showing an expected band of 250 bp and confirmed by amplicon sequencing. Mixed infections with T. vivax (250-bp band) and T. evansi (480-bp band) were detected in three camels (1.2%).

Summary of selected pathogens detected in camels and <italic toggle="yes">Hippobosca camelina.</italic>
Disease pathogen Prevalence in camels ( n = 249) Prevalence in H. camelina ( n = 117)
Trypanosoma vivax 102 (41%) 53 (45.3%)
Trypanosoma evansi 3 (1.2%) 3 (2.56%)
Trypanosoma melophagium 0 (0%) 1 (0.85%)
“ Candidatus Anaplasma camelii” 171 (68.67%) 19 (16.24%)

Out of 117 H. camelina samples, 53 (45.30%) were infected with trypanosomes, all of which had T. vivax. Three flies (2.56%) had mixed infections with T. evansi and T. vivax. Additionally, one fly had double infection of T. vivax and Trypanosoma sp. amplicon of about 400 bp. The 400 bp Trypanosoma sp. was sequenced using the ITS1 marker and shared 98.14% identity with Trypanosoma melophagium (GenBank accession HQ664851) that was sequenced from Melophagus ovinus, sheep ked, in Croatia. Figure 3 shows pairwise alignment of T. melophagium sequence from this study and that from GenBank.

Pairwise alignment of ITS1 sequences of <italic toggle="yes">T. melophagium</italic>.

ITS1 sequence of T. melophagium in study sample H63 was aligned with highly identical sequence (HQ664851) from GenBank. At position 32, there is a nucleotide change from C in the sequence from GenBank to Y in the sequence from this study.

In total 98% of all monoconical trap catches were Stomoxys calcitrans, with the remaining 2% consisting of Tabanidae and H. camelina ( Table 3). None of the traps caught tsetse (0%) in all sampling locations.

Biting flies were trapped using monoconical traps using cow urine and acetone as attractants.

Traps were deployed in selected sampling sites near livestock pens. The traps were set every day at 9:00 am and trapped flies were collected at 6:00 pm. Tsetse flies (genus Glossina) were absent in all traps deployed in Koya, Laisamis and its environs.

Sampling site Fly density per trap/day Sex (M = male; F = female)
Kula pesa 01° 35’ 44.9” N, 037° 48’ 35.8” E 12 12 F – Stomoxys calcitrans
8 5 F – S. calcitrans; 1 M & 2 F – Hippobosca camelina
4 3 F – S. calcitrans; 1 F – H. camelina
12 9 F & 1 M - S. calcitrans; 1 F – Tabanus spp.; 1 M – H. camelina
5 4 F – S. calcitrans; 1 F – H. camelina
11 1 M & 9 F – S. calcitrans; 1 M – H. camelina
8 6 M & 2 F – S. calcitrans
Soweto 01° 35’ 43.1” N, 037° 48’ 35.7” E 2 2 F – S. calcitrans
9 2 M & 7 F – S. calcitrans
7 1 M & 6 F – S. calcitrans
7 2 M & 4 F – S. calcitrans; 1 F – H. camelina
2 2 F – S. calcitrans
9 9 F – S. calcitrans
0 Biting flies count = 0 (Only house flies were trapped)
Naigero 01° 35’ 49.7” N, 037° 49’ 58.1” E 33 8 M & 25 F – S. calcitrans
14 2 M & 12 F – S. calcitrans

“Candidatus Anaplasma camelii ” was detected in 68.67% ( n = 171/249) of dromedary camels and 16.24% ( n = 19/117) of H. camelina ( Figure 4). Though the 300-bp Anaplasma 16S rRNA sequences could not resolve the Anaplasma spp. to species level, analysis of the 1000-bp 16S rRNA nucleotide sequence showed 100% identity with “ Candidatus Anaplasma camelii” sequenced from camels in Saudi Arabia (GenBank accession numbers KF843824-KF843825) and Iran (GenBank accession KX765882). Piroplasms ( Theileria spp. and Babesia spp.), C. burnetii, Ehrlichia spp., Brucella spp., and camel pox were not detected either in camels or keds collected from them.

Melt curves of amplification of 16S rRNA of “ <italic toggle="yes">Candidatus</italic> Anaplasma camelii” in camels and camel keds.

Sequences obtained in the study were deposited in GenBank database with the following accession numbers: short 16S rRNA of Anaplasma spp. in camel (MN306317) and camel ked (MN306316); full length 16S rRNA of “ Candidatus Anaplasma camelii” (MN306315), T. vivax ITS1 in camel (MK880188), and camel ked (MK880189); RotTat 1.2 VSG gene of T. evansi in camel (MK867833) and camel ked (MK867832).

 Discussion

We report the occurrence of similar blood-borne disease pathogens in dromedary camels and in H. camelina flies collected from the same herds. The high infection rates of pathogens in camels ( T. vivax = 41%, T. evansi = 1.2%, and Anaplasma spp. = 68.5%) and flies ( T. vivax = 45.3%, T. evansi = 2.56%, and Anaplasma spp. = 16.24%) suggest the potential of these camel biting flies in disease transmission as well in diagnosis of haemopathogens found in camels. Thus, our findings show T. vivax as the most predominant species causing trypanosomiasis in camels sampled in September 2017 from Koya and its surroundings. Similarly, we recorded high fly infection rates of 45.3% caused by the same parasite, T. vivax. These high T. vivax infection rates could be attributed to mechanical transmission by several biting flies such as Tabanus spp. and Stomoxys species ( Baldacchino et al., 2013) that were collected in this study using monoconical traps ( Table 3). We hypothesize that camels are initially infected with trypanosomes when nomadic pastoralists occasionally move their livestock into distant neighbouring tsetse-infested regions in search of pasture and water, and thereafter maintenance of pathogen transmission among camels continues throughout the year via mechanical transmission in the process of bloodmeal acquisition by biting flies such as camel hippoboscids.

Tsetse flies were not caught despite repeated attempts to trap them in major sampling sites using monoconical traps with cow urine and acetone ( Table 3). Previous reports that support our findings showed absence of tsetse in Laisamis, presumably because this ASAL region is generally arid, hot, and dry (low humidity) with poor vegetation cover making this zone uninhabitable for tsetse flies.

Currently, little is known about the prevalence and transmission of vector-borne diseases of livestock in northern Kenya, mostly because these animals belong to the marginalized poor nomadic pastoralists whose economic welfare is neglected. Thus, information about T. vivax in Kenyan camels is scarce. However, T. vivax has been reported in camels in Sudan, Ethiopia, and Nigeria ( Fikru et al., 2015; Mbaya et al., 2006; Mossaad et al., 2017). The pathogenicity of T. vivax infection in camels is not well understood, but it is known to be pathogenic to cattle, sheep, equines, and goats ( Galiza et al., 2011). Our finding of a high trypanosome infection rate (40.96%) in camels, consisting predominantly of T. vivax, suggests that infected camels could act as parasite reservoirs for other susceptible and often co-herded livestock species in the region.

Trypanosoma evansi infection rates of 1.2% in camels reported in this study is much lower than earlier reports of up to 46% infections in other regions of Kenya ( Ngaira et al., 2004; Njiru et al., 2004). These regional variations in prevalence of T. evansi infection could result from seasonal outbreaks, climate change, disease stability in endemic zones, and the presence of competent insect-vectors, among other factors. Trypanosoma evansi is considered the most important protozoan pathogen of dromedary camels in Kenya ( Njiru et al., 2004) and has been reported to infect horses and donkeys in other parts of the world ( Desquesnes et al., 2013). Additionally, several reports of human infections with T. evansi have been documented ( Truc et al., 2013). Although human infections with T. evansi have not been reported in Kenya, detection of this potentially zoonotic pathogen ( Truc et al., 2013) in camels should stimulate the need for increased surveillance by veterinary and public health partners to mitigate spread of infection to humans and other animals.

“ Candidatus Anaplasma camelii” infection, which we report here for the first time in Kenyan camels, was the most prevalent (68.67%) amongst all detected pathogens in this study. This emergent Anaplasma pathogen was recently detected in 35.85% of Moroccan dromedary camels ( Ait Lbacha et al., 2017). High prevalence of camel anaplasmosis could be attributed to ticks (the definitive vector of Anaplasma) that we observed to be present in 100% of camels, and in addition, biting flies such as Stomoxys calcitrans promote mechanical transmission ( Scoles et al., 2005). Although previous studies could not prove the ability of cattle keds ( Hippobosca rufipes) to transmit Anaplasma marginale ( Potgieter et al., 1981), it is conceivable that in the process bloodmeal acquisition, keds could mechanically transmit anaplasmosis via contaminated mouthparts. The clinical role of “ Candidatus Anaplasma camelii” in camels is uncertain, but oedema has been observed in infected camels ( Ait Lbacha et al., 2017).

The high prevalence of “ Candidatus Anaplasma camelii” in healthy dromedary camels indicates the possible role of camels as reservoir hosts for maintaining its circulation. Further research is needed to determine the zoonotic potential of this tick-borne pathogen. This is important because cases of human infection with Anaplasma platys and Ehrlichia canis, that are closely related to the emergent “ Candidatus Anaplasma camelii” pathogen, have been reported ( Arraga-Alvarado et al., 2014; Doudier et al., 2010).

We detected T. vivax, T. evansi, T. melophagium, and Anaplasma species in Hippobosca camelina. Detection of similar disease haemopathogens in these camel flies ( H. camelina) as well as in camels from which they were collected suggests that this fly could be involved in transmission of infectious agents to other bloodmeal hosts. The ability of H. camelina to fly from one camel to another or to another nearby animal increases its chances of acquiring infected bloodmeal that could then be spread to the next host following interrupted feeding. Various hippoboscid species have been implicated in transmission of disease pathogens. For instance, Hippobosca longipennis is thought to transmit the larva of filarial nematode Acanthocheilonema dracunculoides to hyenas and domestic dogs in Kenya ( Rahola et al., 2011). Louse flies, Melophagus ovinus, play a role in the transmission of Bartonella spp. among ruminants ( Halos et al., 2004). Another louse fly known as Icosta americana is suspected to transmit West Nile virus in north America ( Farajollahi et al., 2005). Further studies are needed to determine the vectorial competence of H. camelina in the transmission of disease pathogens.

Potential role of <italic toggle="yes">H. camelina</italic> in xenodiagnosis

Our findings consistently show that the blood-borne pathogens detected in camels are also present in H. camelina collected from them (i.e. sampled camels). It is likely that when keds bite camel hosts to acquire bloodmeals, they also take up haemopathogens if the camel is infected.

H. camelina acquires bloodmeals from camels for nutrition and reproduction. Keds have claspers for firm attachment to the skin hairs of the host during feeding or resting. These flies that prefer to always remain on the vertebrate host, preferentially attach to specific body parts, commonly on the underbelly ( Figure 2) of the camel, near or on the udder, or the perineal region where they are not easily disturbed during bloodmeal acquisition ( Higgins, 1985). These features of camel keds make them good candidates for xenosurveillance and they can be collected easily for molecular screening to detect disease pathogens acquired from naturally infected camels in the process of feeding. Screening of camel keds for indirect detection of disease pathogens present in camels, from which they were collected, will save on time and cost. Importantly, this xenosurveillance detection provides a less invasive approach than the currently available painful blood collection procedures that pose huge risk to the handlers as camels could occasionally cause severe and even fatal injuries through bites ( Abu-Zidan et al., 2012) or by kicking with their legs. In a similar indirect pathogen detection approach, previous reports showed the utility of mosquitoes in xenosurveillance of human disease pathogens ( Grubaugh et al., 2015).

Additionally, a novel Trypanosoma sp. closely related to Trypanosoma melophagium was detected in one camel ked, H. camelina (1/117) , but not in camels. This host-specific parasite of sheep, called T. melophagium, has never been reported to cause camel infections. Interestingly, T. melophagium is known to be solely transmitted by wingless sheep ked called Melophagus ovinus ( Gibson et al., 2010). We conducted a survey of sheep keds among small ruminants in our study area in northern Kenya and found that they are absent in the region (unpublished study; authors from the present study). Thus, molecular detection of T. melophagium in a single camel-specific ked that was collected from camel raises an interesting question about the origin of this parasite. Possibly, this infected ked, H. camelina, acquired the infection from T. melophagium-infected vertebrate host via blood-feeding when these livestock species are co-herded with camels or during close interaction at shared watering points. Further studies are needed to determine the vectorial competence of H. camelina in transmission of T. melophagium.

 Conclusions

Our findings suggest the potential role of H. camelina in xenodiagnosis for detection of disease haemopathogens in camels, hence bypassing the need to obtain blood samples via jugular venipuncture for pathogen detection. Further studies to profile additional common disease haemopathogens occurring both in camels and H. camelina that fed on them, will be crucial for supporting usage of hippoboscids in xenomonitoring of camel diseases.

 Data availability Underlying data

16S r RNA of Anaplasma sp. in camel, Accession number MN306316: https://www.ncbi.nlm.nih.gov/nuccore/MN306316

16S r RNA of Anaplasma sp. in camel ked, Accession number MN306317: https://www.ncbi.nlm.nih.gov/nuccore/MN306317

16S rRNA of Candidatus Anaplasma camelii, Accession number MN306315: https://www.ncbi.nlm.nih.gov/nuccore/MN306315

T. vivax ITS1 in camel, Accession number MK880188: https://www.ncbi.nlm.nih.gov/nuccore/MK880188

T. vivax ITS1 in camel ked, Accession number MK880189: https://www.ncbi.nlm.nih.gov/nuccore/MK880189

RotTat 1.2 VSG gene of T. evansi in camel, Accession number MK867833: https://www.ncbi.nlm.nih.gov/nuccore/MK867833

RotTat 1.2 VSG gene of T. evansi camel ked, Accession number MK867832: https://www.ncbi.nlm.nih.gov/nuccore/MK867832

Figshare: Detection of Anaplasma and Trypanosomes in camels and camel keds, https://doi.org/10.6084/m9.figshare.10050587 ( Kidambasi et al., 2019).

This project contains the following underlying data:

Raw HRM Rotor-Gene Q data files of Anaplasma spp. amplification in camels and camel keds. HRM data files can be accessed using Rotor-gene Q software.

Gel visualization images of resolved PCR amplicons for detection of African trypanosomes in camels and camel keds.

Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

 Acknowledgements

We are grateful to all camel farmers from Laisamis who consented to sampling of their camels and for actively participating in community engagement sessions. We thank the following community field assistants for restraining camels during sample collection; Galtumo Lordagos, Ogoga Kaldale, Lmachungwan Galgitele, Ltulusuan Letoiye, Moika Naparakwo, Fereiti Bargul, and Ali Baltor. John Ng’iela of icipe’s Animal Health Theme provided invaluable support during field studies. Winny Cherono ( icipe) generated map of Kenya showing sampling sites.

 Abu-Zidan FM Eid HO Hefny AF : Camel bite injuries in United Arab Emirates: A 6 year prospective study. Injury. 2012;43(9):1617–1620. 22186231 10.1016/j.injury.2011.10.039 Ait Lbacha H Zouagui Z Alali S : “ Candidatus anaplasma camelii” in one-humped camels ( Camelus dromedarius) in Morocco: a novel and emerging anaplasma species? Infect Dis Poverty. 2017;6:1. 28160773 10.1186/s40249-016-0216-8 5292149 Arraga-Alvarado CM Qurollo BA Parra OC : Case report: Molecular evidence of Anaplasma platys infection in two women from Venezuela. A J Trop Med Hyg. 2014;91(6):1161–1165. 25266347 10.4269/ajtmh.14-0372 4257640 Rani PA Coleman GT Irwin PJ : Hippobosca longipennis--a potential intermediate host of a species of Acanthocheilonema in dogs in northern India. Parasit Vectors. 2011;4:143. 21781294 10.1186/1756-3305-4-143 3161949 Balamurugan V Bhanuprakash V Hosamani M : A polymerase chain reaction strategy for the diagnosis of camelpox. J Vet Diagn Invest. 2009;21(2):231–237. 19286503 10.1177/104063870902100209 Baldacchino F Muenworn V Desquesnes M : Transmission of pathogens by Stomoxys flies (Diptera, Muscidae): a review. Parasite. 2013;20:26, 13. 23985165 10.1051/parasite/2013026 3756335 Bastos AD Mohammed OB Bennett NC : Molecular detection of novel Anaplasmataceae closely related to Anaplasma platys and Ehrlichia canis in the dromedary camel ( Camelus dromedarius). Vet Microbiol. 2015;179(3–4):310–4. 26096752 10.1016/j.vetmic.2015.06.001 Bengis RG Kock RA Fischer J : Infectious animal diseases: the wildlife/livestock interface. Rev Sci Tech. 2002;21(1):53–65. 11974630 10.20506/rst.21.1.1322 Desquesnes M Dargantes A Lai DH : Trypanosoma evansi and surra: a review and perspectives on transmission, epidemiology and control, impact, and zoonotic aspects. Biomed Res Int. 2013;2013:321237. 24151595 10.1155/2013/321237 3789323 Doosti A Arshi A Sadeghi M : Investigation of Coxiella burnetii in Iranian camels. Comp Clin Path. 2014;23(1):43–46. 10.1007/s00580-012-1567-6 Doudier B Olano J Parola P : Factors contributing to emergence of Ehrlichiaand Anaplasma spp. as human pathogens. Vet Parasitol. 2010;167(2–4):149–154. 19836890 10.1016/j.vetpar.2009.09.016 FAOSTAT: Food and Agriculture Organization statistical database.2015. Reference Source Farajollahi A Crans WJ Nickerson D : Detection of West Nile virus RNA from the louse fly Icosta americana (Diptera: Hippoboscidae). J Am Mosq Control Assoc. 2005;21(4):474–476. 16506578 10.2987/8756-971X(2006)21[474:DOWNVR]2.0.CO;2 Faye B : The Camel Today: Assets and Potentials. Anthropozoologica. 2014;49(2):167–176. 10.5252/az2014n2a01 Fikru R Andualem Y Getachew T : Trypanosome infection in dromedary camels in Eastern Ethiopia: Prevalence, relative performance of diagnostic tools and host related risk factors. Vet Parasitol. 2015;211(3–4):175–181. 26071981 10.1016/j.vetpar.2015.04.008 Galiza GJ Garcia HA Assis AC : High mortality and lesions of the central nervous system in trypanosomosis by Trypanosoma vivax in Brazilian hair sheep. Vet Parasitol. 2011;182(2–4):359–363. 21664764 10.1016/j.vetpar.2011.05.016 Georges K Loria GR Riili S : Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet Parasitol. 2001;99(4):273–286. 11511414 10.1016/s0304-4017(01)00488-5 Gibson W Pilkington JG Pemberton JM : Trypanosoma melophagium from the sheep ked Melophagus ovinus on the island of St Kilda. Parasitology. 2010;137(12):1799–804. 20546642 10.1017/S0031182010000752 Grubaugh ND Sharma S Krajacich BJ : Xenosurveillance: a novel mosquito-based approach for examining the human-pathogen landscape. PLoS Negl Trop Dis. 2015;9(3):e0003628. 25775236 10.1371/journal.pntd.0003628 4361501 Halos L Jamal T Maillard R : Role of Hippoboscidae flies as potential vectors of Bartonella spp. infecting wild and domestic ruminants. Appl Environ Microbiol. 2004;70(10):6302–6305. 15466580 10.1128/AEM.70.10.6302-6305.2004 522062 Higgins AJ : Common ectoparasites of the camel and their control. Br Vet J. 1985;141(2):197–216. 3888345 10.1016/0007-1935(85)90153-8 Kassa T Eguale T Chak H : Prevalence of camel trypanosomosis and its vectors in Fentale district, South East Shoa Zone, Ethiopia. Veterinarski Arhiv. 2011;81(5):611–621. Reference Source Kazoora HB Majalija S Kiwanuka N : Prevalence of Mycobacterium bovis skin positivity and associated risk factors in cattle from western Uganda. Trop Anim Health Prod. 2014;46(8):1383–1390. 25187023 10.1007/s11250-014-0650-1 Kearse M Moir R Wilson A : Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28(12):1647–1649. 22543367 10.1093/bioinformatics/bts199 3371832 Kidambasi K Masiga DK Villinger J : Detection of Anaplasma and Trypanosomes in camels and camel keds. figshare. Dataset.2019. http://www.doi.org/10.6084/m9.figshare.10050587.v1 KNBS, Kenya National Bureau of Statistics: Kenya 2009 population and housing census. Vol II: Population and household distribution by socio-economic characteristics. Kenya National Bureau of Statistics, Government of Kenya.2010. Reference Source KNBS, Kenya National Bureau of Statistics: County Government of Marsabit County Integrated Development Plan, 2013-2017. 2013;16–18. Reference Source Lamuka PO Njeruh FM Gitao GC : Camel health management and pastoralists’ knowledge and information on zoonoses and food safety risks in Isiolo County, Kenya. Pastoralism. 2017;7(1):20. 10.1186/s13570-017-0095-z Mbaya AW Ibrahim UI Apagu ST : Trypanosomosis of The Dromedary Camel ( Camelus dromedarius) and its Vectors in The Tsetse-free Arid Zone of North Eastern Nigeria. Nigerian Veterinary Journal. 2006;31(3):195–200. 10.4314/nvj.v31i3.68975 Mochabo KO Kitala PM Gathura PB : Community perceptions of important camel diseases in Lapur Division of Turkana District, Kenya. Trop Anim Health Prod. 2005;37(3):187–204. 15747856 10.1023/b:trop.0000049301.15826.78 Mossaad E Salim B Suganuma K : Trypanosoma vivax is the second leading cause of camel trypanosomosis in Sudan after Trypanosoma evansi. Parasit Vectors. 2017;10(1):176. 28403897 10.1186/s13071-017-2117-5 5390396 Mwamuye MM Kariuki E Omondi D : Novel Rickettsia and emergent tick-borne pathogens: A molecular survey of ticks and tick-borne pathogens in Shimba Hills National Reserve, Kenya. Ticks Tick Borne Dis. 2017;8(2):208–218. 28011185 10.1016/j.ttbdis.2016.09.002 Ngaira JM Njagi EN Ngeranwa JJ : PCR amplification of RoTat 1.2 VSG gene in Trypanosoma evansi isolates in Kenya. Vet Parasitol. 2004;120(1–2):23–33. 15019140 10.1016/j.vetpar.2003.12.007 Njiru ZK Constantine CC Ndung'u JM : Detection of Trypanosoma evansi in camels using PCR and CATT/T. evansi tests in Kenya. Vet Parasitol. 2004;124(3–4):187–199. 15381299 10.1016/j.vetpar.2004.06.029 Njiru ZK Constantine CC Guya S : The use of ITS1 rDNA PCR in detecting pathogenic African trypanosomes. Parasitol Res. 2005;95(3):186–192. 15619129 10.1007/s00436-004-1267-5 Oryan A Valinezhad A Bahrami S : Prevalence and pathology of camel filariasis in Iran. Parasitol Res. 2008;103(5):1125–1131. 18629537 10.1007/s00436-008-1104-3 Parola P Roux V Camicas JL : Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans R Soc Trop Med Hyg. 2000;94(6):707–708. 11198664 10.1016/S0035-9203(00)90243-8 Petersen FT Meier R Kutty SN : The phylogeny and evolution of host choice in the Hippoboscoidea (Diptera) as reconstructed using four molecular markers. Mol Phylogenet Evol. 2007;45(1):111–122. 17583536 10.1016/j.ympev.2007.04.023 Potgieter FT Sutherland B Biggs HC : Attempts to transmit Anaplasma marginale with Hippobosca rufipes and Stomoxys calcitrans. Onderstepoort J Vet Res. 1981;48(2):119–122. 7312304 Probert WS Schrader KN Khuong NY : Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J Clin Microbiol. 2004;42(3):1290–1293. 15004098 10.1128/jcm.42.3.1290-1293.2004 356861 Rahola N Goodman SM Robert V : The Hippoboscidae (Insecta: Diptera) from Madagascar, with new records from the "Parc National de Midongy Befotaka". Parasite. 2011;18(2):127–40. 21678788 10.1051/parasite/2011182127 3671411 Reysenbach AL Giver LJ Wickham GS : Differential amplification of rRNA genes by polymerase chain reaction. Appl Environ Microbiol. 1992;58(10):3417–8. 1280061 183115 Scoles GA Broce AB Lysyk TJ : Relative efficiency of biological transmission of Anaplasma marginale (Rickettsiales: Anaplasmataceae) by Dermacentor andersoni (Acari: Ixodidae) compared with mechanical transmission by Stomoxys calcitrans (Diptera: Muscidae). J Med Entomol. 2005;42:668–75. 16119558 Šimenc J Potočnik U : Rapid differentiation of bacterial species by high resolution melting curve analysis. Appl Biochem Micro+. 2011;47(3):256–263. 10.1134/S0003683811030136 SSFR, Smart Survey Final Report: Laisamis and North Horr Survey Zones, Marsabit County 18 th– 29 thJanuary 2017. 2017. Reference Source Tokarz R Kapoor V Samuel JE : Detection of tick-borne pathogens by MassTag polymerase chain reaction. Vector Borne Zoonotic Dis. 2009;9(2):147–52. 18800864 10.1089/vbz.2008.0088 2976645 Truc P Büscher P Cuny G : Atypical Human Infections by Animal Trypanosomes. PLoS Negl Trop Dis. 2013;7(9):e2256. 24069464 10.1371/journal.pntd.0002256 3772015 Urakawa T Verloo D Moens L : Trypanosoma evansi: cloning and expression in Spodoptera frugiperda [correction of fugiperda] insect cells of the diagnostic antigen RoTat1.2. Exp Parasitol. 2001;99(4):181–9. 11888244 10.1006/expr.2001.4670 Younan M Abdurahman O : Milk and Meat from the Camel: Handbook on Products and Processing.Z. Farah A. Fischer (Editors), vdf Hochschulverlag AG, ETH Zuerich, Zuerich/Singen, Switzerland.2014;67–76. ISBN 372812527X. Reference Source Young KE Franklin AB Ward JP : Infestation of northern spotted owls by hippoboscid (Diptera) flies in northwestern California. J Wildl Dis. 1993;29(2):278–83. 8487378 10.7589/0090-3558-29.2.278 10.21956/aasopenres.14109.r27252 Reviewer response for version 1 Opiyo Elizabeth A. 1 Referee https://orcid.org/0000-0001-5944-8668 Department of Biology, Faculty of Science, Gulu University, Gulu, Uganda

Competing interests: No competing interests were disclosed.

 20 11 2019 Copyright: © 2019 Opiyo EA 2019 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve

Hippobosca camelina, also known as Keds sampled from camels and blood samples from the camels from which the Keds were samples, were examined for the presence of pathogens with a view of using Keds for xenodiagnosis of camel haemopathogens. The study took place in Laisamis, northern Kenya. The samples were screened using PCR and PCR-HRM and revealed the presence of epizootic pathogens in camels from Kenya and suggests that Keds have potential use in diagnosis of heamopathogens circulating in camels.

In the study design and sampling, no particular sample size or criteria appear to have been planned in advance. If this was opportunistic sampling then this should be stated and justified.

Regarding molecular diagnosis of pathogens, conventional PCR was used for detection of C. burnetii, Anaplasma spp, Ehrlichia spp, Brucella spp and for piroplasma belonging to Theileria and Babesia PCR-HRM and for trypanosomes conventional PCR was followed by visualization and later gel electrophoresis and sequencing. The lack of uniformity in the analysis of the pathogens requires some explanation/justification for the readers that may be interested in doing the same analysis for their studies.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Vector biology and parasitology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Bargul Joel L. International Centre of Insect Physiology and Ecology, Kenya

Competing interests: No competing interests were disclosed.

 7 5 2020

Reviewer: In the study design and sampling, no particular sample size or criteria appear to have been planned in advance. If this was opportunistic sampling then this should be stated and justified.

Response: The type of sampling is now specified as opportunistic sampling and was adopted for convenience by sampling camels from diverse geographical locations as they converge at specific water drinking points. Otherwise it will be challenging to conduct daily sampling of camels considering that camel owners are nomadic pastoralists with busy lifestyles characterized by long distance movements together with their animals and other belongings.

Reviewer: Regarding molecular diagnosis of pathogens, conventional PCR was used for detection of C. burnetii, Anaplasma spp, Ehrlichia spp, Brucella spp and for piroplasma belonging to Theileria and Babesia PCR-HRM and for trypanosomes conventional PCR was followed by visualization and later gel electrophoresis and sequencing. The lack of uniformity in the analysis of the pathogens requires some explanation/justification for the readers that may be interested in doing the same analysis for their studies.

Response: PCR-HRM assays (i.e. combination of both conventional PCR and HRM) were used in detection of all listed pathogens above, except trypanosomes whose detection protocols by HRM are not established at present hence sufficiently screened using conventional ITS-1 PCR by Njiru et al (2005) followed by gene sequencing. The advantage of HRM is that helps in selection of representative samples producing unique HRM melting curves for gene sequencing thus saving on cost.

 10.21956/aasopenres.14109.r27253 Reviewer response for version 1 Muhanguzi Dennis 1 Referee https://orcid.org/0000-0001-5458-8530 School of Biosecurity, Biotechnical and Laboratory Science, College of Veterinary Medicine Animal Resources and Biosecurity, Makerere University, Kampala, Uganda

Competing interests: No competing interests were disclosed.

 18 11 2019 Copyright: © 2019 Muhanguzi D 2019 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve-with-reservations

Reviewer’s Summary

Kidambasi K.O  et al. set out to identify the most important Arthropod-Vectored C. dromedarius pathogens and those in Hippobosca camelina [Camel Keds] as well as to asses the potential use of camel keds in xenodiagnosis of C. dromedarius haemopathogens in Marsabit county, Northern Kenya. They used a battery of molecular techniques to identify the most important parasites circulating in camels [n=249] and Camel Keds [n=117] as T. vivax and T. evansi. As well, Candidatus A. camelli was detected in camels and not Camel keds while T. melophagium was detected in Camel keds and not Camels. Entomological techniques were used to identify Stomoxys calcitrans as the major biting fly in this region. Given a close match of pathogens detected in camels and camel keds that were sampled from them, the authors  discuss herein the potential use of camel keds in xenodiagnosis of camel haemopathogens and the animal and public health roles of the identified hemopathogens.

This is a good manuscript in its area but needs major changes to further improve its quality and scientific merit.

Minor Changes [discretionary]

Please consider implementing the following minor changes

Throughout this manuscript, change the phrase….”disease pathogens” to ‘pathogens’ because all pathogens cause disease

Please consider removing absolute fractions in the results section of the abstract given that you made mention of the number of samples analysed in the methods section of this abstract. If you decide to maintain them, please write them as; Trypanosoma vivax; 41 % [102/249], Trypanosoma evansi; 1.2 % [3/249]. You have indicated that only 200 camel blood samples were analysed to arrive at the prevalence of Candidatus A. camelli. I was unable to find a reason for this in the methods and materials section. Please cross check that this was not quoted in error. In case you did analyze 200 instead of 249 camel blood samples please explain this choice in your materials and methods section.

Please consider changing ---unpredictable rainfalls to … unpredictable rainfall

Rephrase the first sentence of the third paragraph of this section. You can as well break this sentence into two sentences i.e. Hippoboscids (keds) are obligate hematophagous ectoparasites of mammals and birds. They belong to the family Hippoboscidae within the superfamily Hippoboscoidae (Petersen et al., 2007 1 ; Rahola et al., 2011 2 ).

 Methods and materials

Weather conditions: ' ….short and long rains to'……short and long wet seasons

Study design and sample collection: '……samples were collected after receiving informed verbal consent from camel keepers. All camel keepers were neither able to read nor write, thus verbal rather than the written consent was adopted as the pragmatic approach…' This sentence should be moved to Ethical approval on page 4 of 11.

Ethical approval [page 4 of 11]: please delete the sentence that begins with JB…the principal investigator…

DNA extraction [Page 4 of 11]: unless it is the journal requirement, 2.0-mm or 1.5-mL; change this to 2.0 mm or 1.5 mL

Detection of pathogen DNA [page 5 of 11]: Anaplasma and Ehrlichia were detected by PCR amplification using genus-specific primers…. should be changed to …. Anaplasma and Ehrlichia species were detected by PCR amplification using genus-specific primers. Please rewrite the sentence……….. Brucella arbutus forward primer, B. melitensis forward primer, and Brucella spp. universal reverse primer targeting the IS711 gene (Probert et al., 2004), 5.5 μL PCR water and 1.0 μL of template DNA. …..Camel pox…. in the last paragraph of this section as well as table 1 should be changed to Camel pox Virus [CMLV]. As you will remember, you did not detect the disease but CMLV genetic material.

DNA purification and sequencing [page 5 of 11]. Second sentence of this section …..The PCR amplicons….is incomplete. Please complete this sentence.

Data analysis: Please delete the sentence that begins with….. Ground truthing….Ground truthing applies more to remote sensing and machine learning. You just need to explain how the map in figure 1 was drawn in the sentence that follows. Here you will need to mention the ArcGIS v. 10.6 extension that you used to complete this map.

Results: Please transfer contents of paragraph 4 that start with ….sequences obtained in the study… to an appropriate section under methods and materials. As well, explanatory text of Table 3 on page 8 of 11 sounds like methods and materials information. Please keep that in methods and materials and provide a stand-alone legend for this table if required.

 Major comments: Methods and Materials: There is need to include sections on Sample size determination and sampling strategy as well as to improve the current sub-sections under this section. In your introduction section, you indicated that about 3 million camels are kept in northern Kenya. Under methods and materials, there is no explanation of how many of these 3 million camels are kept in Laisamis or even Marsabit County. Reading this manuscript the following questions arise. Are 249 camels sampled over 5 days period  representative of n camels in the study country or Laisamis zone? Are the Laisamis camels representative of all the 3 million camels in Nothern Kenya? Were all the camels presented in the 5 sampling days sampled so long as their owners consented to the study?, If not, how were the 249 camels sampled from n 2 camels presented during the 5 sampling days? Why was sampling only done in September [short wet season]?  How were the 21 sampled herds [at 4 sites] arrived at? How many herds were there in the county and how were the 21 herds selected from all the county camel herds? What is the definition of a herd given that animals that are owned in a communal pastoral husbandry obtaining mix-up? What was the sampling unit? How were the sites for biting fly trapping selected and what was the inter trap distance? etc…\

Data analysis needs to be revisited. The fly apparent density in table 3 can be well presented spatially. To be able to discuss possibility of mechanical transmission of different hemopathogens by different biting flies e.g. Stomoxys the association between fly apparent density and hemopathogen prevalence needs to be adjusted for potential spatial dependence. This you can do using generalized least squares model with a Gaussian spatial correlation structure to quantify the effect or other appropriate models.

Please include a pairwise alignment of Candidatus A. camelli from this study and those from the GenBank as was done for T. melophagium

Discussion: I would like to draw the authors’ attention to some of the following discussion sections which I strongly believe they need to revisit.

First paragraph [Page 7 of 11]: Associating the high prevalence of hemopathogens in camels to the potential of camel keds in hemopathogen transmission is not supported by the results of this study. Note that keds were only less than 2% of all biting flies trapped. This can only be attributed to mechanical transmission of these hemopathogens by Stomoxys Calicitrans and Tabanids which were >98% of all biting flies trapped. You can be authoritative about these associations if you improve data analysis as recommended in comment II above

Pursuant to comment 13 above, you need to rewrite the hypothesis you make at the end of paragraph 1 of discussion section on page 7 of 11. If Mechanical transmission of camel hemopathogens were important in this region, it would rather be by Stomoxys and other Tabanids and not camel keds [camel keds were <2% of all biting flies trapped]; moreover you did not rule out or in potential spatial dependence between hemoparasite prevalence and  fly apparent density.

Paragraph 2 of discussion [page 7 of 11]. There is mention of reports that support absence of tsetse flies in the study area and yet no references of such reports are included. When I checked this fact myself, I found that this study area has recently been cited as an area with high risk of tsetse infestation using robust landscape and climatic data modeling 3 .

Last paragraph on page 7 of 11; The variations in the micro-climatic conditions, differences in the study designs and time lapse are the most likely explanations for the differences in T. evansi prevalence in camels previously reported in other parts of Kenya and in this study.

There is need to include a discussion of the limitations of this study [see major comment I & VII above. Think of snap short sampling during short wet season? seasonality vs hemoparasite and vector density etc

There is need to nuance the recommendation about heightening public and veterinary surveillance of T. evansi as a zoonotic hemoparasite [first paragraph, page 9 of 11] because there are no reported major outbreaks of this atypical human African trypanosomiasis either in Kenya or elsewhere ever reported. The only cases of atypical T. evansi human infections have been reported in either immunocompromised or accidental infections 4  that do not warrant setting up veterinary and public health surveillance programs.

Second last sentence; paragraph 2, page 9 of 11….it is conceivable …. . This needs to be reinterpreted. Finding Candidatus A. cameli in keds and camels certainly means that keds are feeding predominantly on camels positive for Candidatus A. cameli. This study design was not to prove mechanical transmission of   Candidatus A. cameli by Keds; given that previous mechanical transmission studies were not able to prove that, it is not conceivable in a study of such a design to make this assertion.

Second sentence of paragraph 4 page 9 of 11…….detection of similar haemopathogens in these camel flies…… This needs to be reinterpreted. Finding a similar repertoire of hemoparasites in keds and in camels only indicates that keds were feeding on hemoparasite positive camels. Only 2 % of the caught biting flies were keds and you can’t emphasize ked mechanical transmission than that of Tabanids and Stomoxys which were > 98% of all biting flies trapped; with known mechanical transmission potential. The only application you can make out of this result is about xenodiagnosis and not mechanical transmission of hemoparasites by keds unless this is proven in study with suitable study design or you can refer to literature!

Page 10 of 11, first sentence: The point you make about xenodiagnosis saving time and money needs to be substantiated. It takes as much time to collect keds from camels as it takes to take blood samples from camels. If similar diagnostic methods are used to detect pathogens in keds and camels, I would not anticipate pathogen detection in keds to be any cheaper than pathogen detection in camels? can you please discuss how xenodiagnosis would be cheaper and shorter than detection of pathogens directly from camel blood?

Last paragraph of discussion section, page 10 of 11. ; …..Molecular detection of T. melophagium….

 Note that detection of this parasite in a ked does not mean that such a ked was infected with T. melophagium. Unless proven, it would mean that it had consumed a blood meal from a host [might not be camel at all since no camel was found positive for genetic material of this parasite] that had been positive for T. melophagium genetic material. This has nothing to do with H. camelina being able to transmit [biologically or mechanically] T. melophagium.

Conclusion

This needs to be refined after refining the discussion. Blood samples need not to be taken from the Jugular. You can these days take blood samples [125 ul]  from ear veins and have them preserved on FTA cards. Unless substantiated as in comment XII, this conclusion has to be rewritten so that it is supported by the findings of this study.  

References

As indicated in my comments above, the attention of the authors is drawn to some of the key literature they were not able to refer to in their discussion section e.g Truc et al. 4 , Moore et al. 3 .

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Molecular epidemiology, Spatial epidemiology, Veterinary Sciences

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

References : Protective effect of antibiotics against serious complications of common respiratory tract infections: retrospective cohort study with the UK General Practice Research Database. BMJ .2007;335(7627) : 10.1136/bmj.39345.405243.BE 982 17947744 10.1136/bmj.39345.405243.BE : The Hippoboscidae (Insecta: Diptera) from Madagascar, with new records from the "Parc National de Midongy Befotaka". Parasite .2011;18(2) : 10.1051/parasite/2011182127 127-40 21678788 10.1051/parasite/2011182127 : A landscape and climate data logistic model of tsetse distribution in Kenya. PLoS One .2010;5(7) : 10.1371/journal.pone.0011809 e11809 20676406 10.1371/journal.pone.0011809 : Atypical human infections by animal trypanosomes. PLoS Negl Trop Dis .2013;7(9) : 10.1371/journal.pntd.0002256 e2256 24069464 10.1371/journal.pntd.0002256 Bargul Joel L. International Centre of Insect Physiology and Ecology, Kenya

Competing interests: No competing interests were disclosed.

 7 5 2020

Minor Changes [discretionary]

Please consider implementing the following minor changes

1.     Throughout this manuscript, change the phrase….”disease pathogens” to ‘pathogens’ because all pathogens cause disease

Response: This has been corrected throughout the manuscript.

2.     Please consider removing absolute fractions in the results section of the abstract given that you made mention of the number of samples analysed in the methods section of this abstract. If you decide to maintain them, please write them as; Trypanosoma vivax; 41 % [102/249], Trypanosoma evansi; 1.2 % [3/249]. You have indicated that only 200 camel blood samples were analysed to arrive at the prevalence of “ Candidatus A. camelii”. I was unable to find a reason for this in the methods and materials section. Please cross check that this was not quoted in error. In case you did analyze 200 instead of 249 camel blood samples please explain this choice in your materials and methods section.

Response 1: absolute fractions have been removed from the results section of the Abstract.

Response 2: we analyzed a total of 249 samples as specified under ‘Materials and Methods’ section, and not 200 as quoted in the Abstract. We apologize for this error that is now corrected.

3.     Please consider changing ---unpredictable rainfalls to … unpredictable rainfall

Response: done.

4.     Rephrase the first sentence of the third paragraph of this section. You can as well break this sentence into two sentences i.e. Hippoboscids (keds) are obligate hematophagous ectoparasites of mammals and birds. They belong to the family Hippoboscidae within the superfamily Hippoboscoidae (Petersen et al., 20071; Rahola et al., 20112).

Response: done.

Methods and materials

5.     Weather conditions: ' ….short and long rains to'……short and long wet seasons

Response: Done

6.     Study design and sample collection: '……samples were collected after receiving informed verbal consent from camel keepers. All camel keepers were neither able to read nor write, thus verbal rather than the written consent was adopted as the pragmatic approach…' This sentence should be moved to Ethical approval on page 4 of 11.

Response: Above sentences have now been moved to “Ethical approval” section.

7.     Ethical approval [page 4 of 11]: please delete the sentence that begins with JB…the principal investigator…

Response: Deleted

8.     DNA extraction [Page 4 of 11]: unless it is the journal requirement, 2.0-mm or 1.5-mL; change this to 2.0 mm or 1.5 mL

Response: Done

9.     Detection of pathogen DNA [page 5 of 11]: Anaplasma and Ehrlichia were detected by PCR amplification using genus-specific primers…. should be changed to …. Anaplasma and Ehrlichia species were detected by PCR amplification using genus-specific primers.

Response: Done

Please rewrite the sentence……….. Brucella arbutus forward primer, B. melitensis forward primer, and Brucella spp. universal reverse primer targeting the IS711 gene (Probert et al., 2004), 5.5 μL PCR water and 1.0 μL of template DNA. …..Camel pox…. in the last paragraph of this section as well as table 1 should be changed to Camel pox Virus [CMLV]. As you will remember, you did not detect the disease but CMLV genetic material.

Response: Rephrased

10.  DNA purification and sequencing [page 5 of 11]. Second sentence of this section …..The PCR amplicons….is incomplete. Please complete this sentence.

Response: we apologize for this mistake and thank you for being very keen; the word ‘were’ is now inserted to complete the sentence.

11.  Data analysis: Please delete the sentence that begins with….. Ground truthing….Ground truthing applies more to remote sensing and machine learning. You just need to explain how the map in figure 1 was drawn in the sentence that follows. Here you will need to mention the ArcGIS v. 10.6 extension that you used to complete this map.

Response: We thank the Reviewer for this suggestion that we have effected to improve the manuscript.

12.  Results: Please transfer contents of paragraph 4 that start with ….sequences obtained in the study… to an appropriate section under methods and materials.

Response: this paragraph is now appropriately placed under ‘methods and materials’ section.

As well, explanatory text of Table 3 on page 8 of 11 sounds like methods and materials information. Please keep that in methods and materials and provide a stand-alone legend for this table if required.

Response: Many thanks for this comment, we have re-written heading of Table 3.

13.  Major comments: Methods and Materials: There is need to include sections on Sample size determination and sampling strategy as well as to improve the current sub-sections under this section. In your introduction section, you indicated that about 3 million camels are kept in northern Kenya. Under methods and materials, there is no explanation of how many of these 3 million camels are kept in Laisamis or even Marsabit County.

Reading this manuscript the following questions arise. Are 249 camels sampled over 5 days period representative of n camels in the study country or Laisamis zone? Are the Laisamis camels representative of all the 3 million camels in Nothern Kenya? Were all the camels presented in the 5 sampling days sampled so long as their owners consented to the study?, If not, how were the 249 camels sampled from n2 camels presented during the 5 sampling days? Why was sampling only done in September [short wet season]?  How were the 21 sampled herds [at 4 sites] arrived at? How many herds were there in the county and how were the 21 herds selected from all the county camel herds? What is the definition of a herd given that animals that are owned in a communal pastoral husbandry obtaining mix-up? What was the sampling unit? How were the sites for biting fly trapping selected and what was the inter trap distance? etc…

Response: more information is now provided, for instance, a recent study reported a total population of 203,320 camels in Marsabit County, where our present study was conducted (SSFR, 2017).

This field study was cross-sectional in design and involved opportunistic sampling, whereby we sampled camels converging at the water drinking points. This type of sampling was most convenient due to the nomadic pastoralist lifestyle involving frequent long distance movements. We sampled all camels in the herds found at water drinking points for 5 consecutive days in the dry season (September 2017). Due lack of data, we could not calculate the sample sizes, thus we collected as many samples as possible during the sampling duration.

Sampling was preferred in dry season of September because then the camel ked densities are high, unlike during wet season.

Flies were randomly collected from 21 camel herds (that was possible in 5 days) and we targeted to collect as many keds infesting camels as possible. The herds were from four sites. We do not have data on the number of herds in this community whose main occupation of the Household Heads is livestock herding at 87%, followed by Casual Labor (SSFR, 2017). We defined a camel herd as one under care of a specific farmer and it comprises of camels that graze and stay together most of the time. Much as we tried to avoid sampling of camel herds that mostly co-graze, this did not affect our objective of studying pathogens in camels and keds kept under natural setting. All camels, in each herd that ranged from 8 – 90 camels, were sampled and we aimed to collect all camel keds from the sampled camel herds.

The sites for biting fly trapping were selected near livestock pens and next to watering points along Laisamis and Koya Rivers. The inter trap distance was at least 100 meters.

14.  Data analysis needs to be revisited. The fly apparent density in Table 3 can be well presented spatially. To be able to discuss possibility of mechanical transmission of different haemopathogens by different biting flies e.g. Stomoxys the association between fly apparent density and hemopathogen prevalence needs to be adjusted for potential spatial dependence. This you can do using generalized least squares model with a Gaussian spatial correlation structure to quantify the effect or other appropriate models.

Response: It is not possible to do these analyses with our limited data. Our key focus was on camel keds infesting camels. Since our preliminary data showed high prevalence of camel trypanosomiasis in the study region, we therefore wanted to check whether tsetse flies are present to cause disease transmissions. Three traps were deployed per site on daily basis. Daily trap collections were pooled, fly species sorted, counted, and preserved in absolute ethanol ready for transportation to the Nairobi-based laboratories at icipe (Table 3).

15.  Please include a pairwise alignment of “ Candidatus A. camelii” from this study and those from the GenBank as was done for T. melophagium

Response: we thank the reviewer for this helpful addition. This alignment is now provided as Figure 5.

16.  Discussion: I would like to draw the authors’ attention to some of the following discussion sections, which I strongly believe they need to revisit.

17.  First paragraph [Page 7 of 11]: Associating the high prevalence of hemopathogens in camels to the potential of camel keds in hemopathogen transmission is not supported by the results of this study. Note that keds were only less than 2% of all biting flies trapped. This can only be attributed to mechanical transmission of these hemopathogens by Stomoxys Calcitrans and Tabanids which were >98% of all biting flies trapped. You can be authoritative about these associations if you improve data analysis as recommended in comment II above

Response: As described under ‘materials and methods’ and ‘discussion’ sections, camel keds do not normally leave their host (unless when disturbed) as they firmly attach to the hairs on the camel’s skin by their tarsal claws during feeding or resting. During our study, keds were common on the camels which was not the case for other biting flies. The keds can hop from one camel to another when disturbed and if they are contaminated they could transmit the pathogens to the next host as shown by preliminary findings of our ongoing studies (Bargul et al., unpublished). Thus, our intention to deploy fly traps was mainly to catch tsetse flies and other biting fly species but not keds as we understand at present that efficient traps for keds are not available and the monoconical traps we deployed are efficient at trapping tsetse flies, as well as biting flies such as Stomoxys and Tabanids, with house flies often being non-targets. Our ongoing studies aim at designing ked-specific traps. It is very likely that the few trapped keds comprising of 0 - 2% of total biting fly catches were off targets.

18.  Pursuant to comment 13 above, you need to rewrite the hypothesis you make at the end of paragraph 1 of discussion section on page 7 of 11. If Mechanical transmission of camel haemopathogens were important in this region, it would rather be by Stomoxys and other Tabanids and not camel keds [camel keds were <2% of all biting flies trapped]; moreover you did not rule out or in potential spatial dependence between haemoparasite prevalence and fly apparent density.

Response: please refer to #13 above that partially addresses this question.

Although Stomoxys and Tabanids are potential mechanical vectors of pathogens as previously reported, we do not have data to affirm their vectorial competence in disease transmission among camels in northern Kenya. The major focus of our study was on the ectoparasitic camel keds, but not on the other biting flies that were often absent on camels, unlike keds. In fact, our motivation to deploy traps was to determine occurrence of tsetse flies (definitive biological vectors of African trypanosomes) as camel trypanosomiasis was detected in almost half of the sampled camels. Our preliminary findings from ongoing studies show evidence of Anaplasma transmission by camel keds from naturally infected dromedary camels to laboratory-reared mice and rabbits (Bargul et al., unpublished). We are also testing trypanosome transmission capacity of camel keds as keds are the closest tsetse relatives both belonging to same superfamily.

19.  Paragraph 2 of discussion [page 7 of 11]. There is mention of reports that support absence of tsetse flies in the study area and yet no references of such reports are included. When I checked this fact myself, I found that this study area has recently been cited as an area with high risk of tsetse infestation using robust landscape and climatic data modeling3.

Response:  Despite the high risk prediction for tsetse infestation in our study area (Moore and Messina, 2010), we did not collect any tsetse flies during the sampling period. Additionally, during our community and public engagement sessions, the camel farmers reported absence of these flies in Laisamis, but in the far regions such as Meru County, over 200 km away.

20.  Last paragraph on page 7 of 11; The variations in the micro-climatic conditions, differences in the study designs and time lapse are the most likely explanations for the differences in T. evansi prevalence in camels previously reported in other parts of Kenya and in this study.

Response: these factors that could influence disease prevalence are now better reflected in the discussion, i.e.

“These regional variations in prevalence of T. evansi infection could result from seasonal disease outbreaks, variations in the micro-climatic conditions, disease stability in endemic zones, and the presence of competent insect-vectors, among other factors, including differences in the study designs and time lapse. Our study design has key limitations in comparative studies because sampling was not done during wet season, thus the relationship between seasonality versus prevalence of haemoparasites and vector density could not be established”

21.  There is need to include a discussion of the limitations of this study [see major comment I & VII above. Think of snapshot sampling during short wet season? Seasonality vs haemoparasite and vector density, etc.

Response: limitations of our study design are now highlighted in the discussion. Please see #17 above.

22.  There is need to nuance the recommendation about heightening public and veterinary surveillance of T. evansi as a zoonotic haemoparasite [first paragraph, page 9 of 11] because there are no reported major outbreaks of this atypical human African trypanosomiasis either in Kenya or elsewhere ever reported. The only cases of atypical T. evansi human infections have been reported in either immunocompromised or accidental infections that do not warrant setting up veterinary or public health surveillance programs.

Response: we fully agree that T. evansi human infections are very uncommon, thus we deleted our earlier suggestion proposing “increased surveillance by veterinary and public health partners to mitigate spread of T. evansi in humans”

23.  Second last sentence; paragraph 2, page 9 of 11….it is conceivable …. . This needs to be reinterpreted. Finding “ Candidatus A. camelii” in keds and camels certainly means that keds are feeding predominantly on camels positive for “ Candidatus A. camelii”. This study design was not to prove mechanical transmission of “ Candidatus A. camelii” by Keds; given that previous mechanical transmission studies were not able to prove that, it is not conceivable in a study of such a design to make this assertion.

Response: yes, it is true that the focus of this study was not to prove mechanical transmission of pathogens. However, we show that identical Anaplasma species in camels and keds collected from them, suggesting that keds fed on Anaplasma-positive camels. Based on this finding, we hypothesize that in the process of blood-feeding, keds, just like Stomoxys calcitrans, could mechanically transmit anaplasmosis via contaminated mouthparts. We have preliminary data, from another ongoing study, to support “ Candidatus A. camelii”-transmission by camel keds from naturally-infected camels to mice and rabbits (Bargul et al., unpublished).

24.  Second sentence of paragraph 4 page 9 of 11…….detection of similar haemopathogens in these camel flies…… This needs to be reinterpreted. Finding a similar repertoire of haemoparasites in keds and in camels only indicates that keds were feeding on haemoparasite positive camels. Only 2% of the caught biting flies were keds and you can’t emphasize ked mechanical transmission than that of Tabanids and Stomoxys which were > 98% of all biting flies trapped; with known mechanical transmission potential. The only application you can make out of this result is about xenodiagnosis and not mechanical transmission of haemoparasites by keds unless this is proven in study with suitable study design or you can refer to literature!

Response: please note that this is already addressed under response #13, #14, & #19 above.

25.  Page 10 of 11, first sentence: The point you make about xenodiagnosis saving time and money needs to be substantiated. It takes as much time to collect keds from camels as it takes to take blood samples from camels. If similar diagnostic methods are used to detect pathogens in keds and camels, I would not anticipate pathogen detection in keds to be any cheaper than pathogen detection in camels? Can you please discuss how xenodiagnosis would be cheaper and shorter than detection of pathogens directly from camel blood?

Response: Collection of keds off camels was much easier and required relatively less time than blood sampling., We employed six field assistants to restrain each camel for blood collection, a veterinary personnel who collected blood samples, and additional three assistants to carry cool boxes and consumables, ensure accurate labeling of samples and storage, and recording of baseline data. On the other hand, only about four field assistants were needed to collect keds from camel herds, resulting in >50% reduction in labour costs and the required human resource. Fly collection also took shorter time as it was not necessary to restrain camels. Importantly, this xenosurveillance detection provides a less invasive approach than the currently available painful blood collection procedures that pose huge risk to the handlers as camels could occasionally cause severe and even fatal injuries through bites (Abu-Zidan et al., 2012) or by kicking with their legs.

26.  Last paragraph of discussion section, page 10 of 11. ; …..Molecular detection of T. melophagium….

Note that detection of this parasite in a ked does not mean that such a ked was infected with T. melophagium. Unless proven, it would mean that it had consumed a blood meal from a host [might not be camel at all since no camel was found positive for genetic material of this parasite] that had been positive for T. melophagium genetic material. This has nothing to do with H. camelina being able to transmit [biologically or mechanically] T. melophagium.

Response: we agree with the reviewer, and subsequently this sentence has been re-written to ensure accurate delivery of information.

Conclusion:

This needs to be refined after refining the discussion. Blood samples need not to be taken from the Jugular. You can these days take blood samples [125 ul] from ear veins and have them preserved on FTA cards. Unless substantiated as in comment XII, this conclusion has to be rewritten so that it is supported by the findings of this study. 

Comment: with the above clarification on xenodiagnosis under #21, our conclusions are now well supported.

References

As indicated in my comments above, the attention of the authors is drawn to some of the key literature they were not able to refer to in their discussion section e.g Truc et al.4, Moore et al.3.

Comment: many thanks to the Reviewer for your helpful suggestions. We have now added the following references; Rahola et al., 2011, Nelson, 1963, Moore and Messina, 2010, Vanhollebeke et al., 2006, Truc et al., 2013

References

1.     Petersen I, Johnson AM, Islam A, Duckworth G, et al.: Protective effect of antibiotics against serious complications of common respiratory tract infections: retrospective cohort study with the UK General Practice Research Database.BMJ. 2007; 335 (7627): 982 PubMed Abstract | Publisher Full Text (not cited as it seems unrelated to our study)

2.     Rahola N, Goodman SM, Robert V: The Hippoboscidae (Insecta: Diptera) from Madagascar, with new records from the "Parc National de Midongy Befotaka".Parasite. 2011; 18 (2): 127-40 PubMed Abstract | Publisher Full Text (was already cited)

3.     Moore N, Messina J: A landscape and climate data logistic model of tsetse distribution in Kenya.PLoS One. 2010; 5 (7): e11809 PubMed Abstract | Publisher Full Text (cited)

4.     Truc P, Büscher P, Cuny G, Gonzatti MI, et al.: Atypical human infections by animal trypanosomes.PLoS Negl Trop Dis. 2013; 7 (9): e2256 PubMed Abstract | Publisher Full Text (was already cited)